?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB28YB19FM1
Length(NT) : 728
Member of Contig: SY0AAB28YB19FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein An12g06340 [Aspergillus niger]3223e-28 ref|XP_001395694.1|

Sequence:

>SY0AAB28YB19FM1
TTGGGGTTGGGAGATGCTTACGATGCAACGTTAGGTCGGGTAAAGGGACA
GGGTGGCGAGAAAGCGAAGCTCGGTATGGCCGTATTGATGTGGATCTCTC
ATGTGGAGCGGCCCTTAAAGGCCGACGAGCTGTGTCACGCCCTAGCAGTC
GAAATAGGGTCGCCAGATCTCAATACCGACAATGTTCCTTCAATAGGGAC
ATTGTTAGCCTGTTGTCAAGGACTTGTTACCATAGACGGAGAGGCTTCGA
CGGTCCGCTTAATTCACTTTACCCTTCAAGAGTACCTCCGGGCTCATCCC
GAGATTTCCGCCACAGCTCACTCAACAATGGCAGAAACCTGCTTAAGTTA
TCTGAATTCTCAGCAGGTCAGGGCTCTCTCGGCCAGTCCTTCTCTCTATC
TCCAAGATACGCCCTTTTTAGAATATTCTTCTCTATATTGGGGAATTCAC
GCGAAAAGAAACCTTTCAGATTGTGCCAAGTTGCTTGCGCTGAGGCTATT
TAACGATTACAATAACCACATATCCACTAAAATCCTCTTGGAAGCGCAGA
AATGGTATCTGTACGAAGTTGATTTCGATAGGTTTTGGTTATTCAGCGGT
CTACATTGCGCATCAATCTTCGGGATTGCTGAGATTGTAGCTTGTTTGGT
AGAGGCGGAAGGTTGTGATATCAACCAAAAAGACTGCACGGGTAATACTC
CTCTCGTGTGGGCTGCTAACAATGGACA

NCBI BlastX