?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB28YA15FM1
Length(NT) : 625
Member of Contig: SY0AAB28YA15FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
ribosomal L10 protein [Paracoccidioides brasiliensis]5564e-89 gb|AAO47090.1|

Sequence:

>SY0AAB28YA15FM1
TTGGCCCATATCACCAAATCTACACCTTCTCACTTCTCCACACAGATATT
CAGGAAAGATGGCCCGTAGACCCGCTCGCTGCTACCGCTACTGCAAGAAC
AAACCCTACCCCAAGTCACGCTTCAACCGTGGTGTTCCCGACCCCAAGAT
TCGTATCTTCGATTTGGGACGCAAGCGTGCCGGTGTTGACGAATTCCCCC
TTTGCGTCCACTTGGTTTCTAACGAGTACGAACAACTTTCTTCTGAGGTA
TGAATTGTTCCTCGTCCAGTGATGATGTTAGAGGGCCCTCGAAGCTGCCC
GTATTTGCGCCAACAAGTATCTTGTCAAAATTGCTGGAAAGGATGGTTTC
CACATGAGAGTCCGTGCTCACCCCTTCCACGTTATTCGTATCAACAAGAT
GTTGTCTTGTGCTGGAGCCGATAGACTTCAAACTGGTATGCGTGGTGCTT
GGGGTAAGCCTAACGGAACTGTCGCCCGTGTCAACATTGGTCAAATCATT
CTGTCCGTGAGGACACGTGATACACACCGTGCGACCGCTATCGAGGCTCT
GAGGAGGTCCCAATATAAGTTCCCCGGTCGCCAAAAGATCATTGTCTCTA
AGAACTGGGGCTTCACACCCCTTCG

NCBI BlastX