?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB24YJ08FM1
Length(NT) : 375
Member of Contig: SY0AAB24YJ08FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
No hit found

Sequence:

>SY0AAB24YJ08FM1
TTGGGCAAGAGGAGGAGGAGGAGGAGGAGAGGGGATGGTTTGTAGAAGAG
GAAGTGGGCGGTTCCCAGGCGCCCGGTGGCGCGAGGAGGTTCGCTGTTGA
CGACGAGGAAGCCGGCACCGCTGGCCCCTCAACCAAACCAGCTCAGAGGG
ATTCCCTCTCATGCGAAATCGACTCAGACCCGTTTGTGCAGCTCGCCTGC
ACCAAGCCCGACCTGCGGCCCCCTGTGCGCTCTGGGTTTCTGACGGAGTC
ATCATGGGCGGCAGCCCGGCGTCCACGTTACGATGGTGCCCAGGACAGCC
GGACTGCCTCCCCGCCTCAGATTCGTGGCGGTCGCCTGGCCTCCCACCCG
TTGCTGCGACTATGGTGCCCCCTCC

NCBI BlastX