?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB24YD23FM1
Length(NT) : 639
Member of Contig: SY0AAB24YD23FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
ankyrin repeat domain protein [Neosartorya fischeri NRRL 181]3563e-32 ref|XP_001258986.1|

Sequence:

>SY0AAB24YD23FM1
TTGGGGGAGTGGTAAAAGCACTGCTTGGACGGGACGACATCAGTCCCGAC
AAACCAGATAACAACGGCCAAACACCACTCTGGTGTGCCGCTCGGAGCGG
GTACGTGGGAGTGGTGAAAACACTGCTCGGATGGGGCGATATTAATCCCA
ACGCACCAGATGATGATGGCCAAACGCCACTCCATACTGCAGCCTGGAAT
GGGCACGAGGAAGTGGTGAAAGTACTGCTCTGGCGGAACGATGTCGACCC
CAACAAACTAGGAGGCGATGGCCAAACACCACTCGGTTGGGCCGCTAGGC
ACGGTGACGGAGGAGTGGTGAAAGCGTTACTCGCACGGGGTGACACCAAC
CCCGACAAGCCTGACCACTTAGGCCGAACACCGCTCTGGTGGGCCGCCGA
GCATCGCCATGCAGGAGTAATGACGCTACTACAGTGCCCAACATCTGCCA
CCCGTAGCACAGGCTAGGGTACAGGGGGCGTCTCCCAAATACGGGCTTTC
AATCTACCAAGTGCGCATGAAAAACAGCTCAAGGAAGATTTCTACTGCCG
CCGTCGCCTCTCTCGCCCCCGCCCGGTCTCCTCCCACAGTTGAAGCGCCA
CGTTCTCGTCGCAGCCGTCTTTCCCTCCCTTCTGGGGTA

NCBI BlastX