?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB24YA03FM1
Length(NT) : 687
Member of Contig: SY0AAB24YA03FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein An12g05680 [Aspergillus niger]3043e-26 ref|XP_001395633.1|

Sequence:

>SY0AAB24YA03FM1
TTGGCGAGGTATATTTTCGAATCAATAACTCGCACAAAGAGTCCGCACAA
ATTTTTCACCATCTTTTCGAACCCAGCCAGATTCCCGATGTCCTTGGTTG
ACTTGAACTCCCGCCTGATTCGGAATGCGATGTTCATCTCTTGGAGTGTA
AGAGGCCTCGCTGCCGCCACCACGATATTAAGGATTCGTCGGGCTTTGTC
GGGGCTTTTACTCTTATCAAGAATCCTGGTGTATAGTTCTGCTATATCGG
GTGGTGCGGTGGAGACAATCTCGGTGAAGGCCTCCGGTGATCCATCCTCG
CTATTCCGCAAAATATCAAGAACAAGAGAAACCCAAAGGAATGTCCGATC
GGCGGAAGATTCGAGAAGATTTCGCAAATATCCCAGCCCCCCGGGCTGTT
CCCAGTATGACTCTAGGTCTTCAATCCCTGCTTCTATGACACGAGTAACA
TCGGCAGTGGTAGCGGTGACCTCTTCCTCCCCTTTCAACCTGATGGTGGT
TGCGGGTGAGCCTAGCTGTCTCTCGATCTTGTGGTAGGGGCGACTCGTAA
CTAGAAATTTCAAAGGAATATAAGAAGTCTCTGACCCAGGGAGATTGGTG
GCATGATGGATAAGCCGGGTTAAAGTCCCTTCGTCACACTCGTCCAATGC
ATCCACCACACAAATTACATTGCCGCACCCCCCCTCA

NCBI BlastX