?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB23YF11FM1
Length(NT) : 606
Member of Contig: SY0AAB23YF11FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
photo-regulated tyrosinase [Polyporus arcularius]1663e-10 dbj|BAD51402.1|

Sequence:

>SY0AAB23YF11FM1
TTGGGATTTGTCAACTTTTGTCACAGGTAGGGTCAACGAACTTTATAGGC
CTGCTTTGGGTGGCGGTGGTGGCAATAATCCAGGCCCCGGCACCGGCACG
GGTACTGGCAATGGCACCGGCACAGGTACTGGTTCGGGCTCTGGTTCTGG
CTCTGGTTCTGGCTCTGGTTCGGGCTCTGGTTCTGGCTCTGGTTCGGGCT
CTGGTTCTGGCTCCGGCTCTGGCTCAGGAACTGGCAGTCCCTACAGATAC
CGTCGCGAATGGATCGCCTACATCAAAATGGACACAGGCGAGGTCGATGA
TAGATACTCTGTCTTGATCTTCCTTGGAGACGTCCCATCATCCGTCCAAG
AATGGCAAACTGCACCAAATCACGTTGGCGACTGCTCAACATTCGGCGAC
GAGAGATCGCGAATGAAACACGTTATCCGAGGCACTGTACCTCTGACCGA
GGCCCTCGTCGCGAGCAATGTCGACCTTGACCCGGCCGCGTGTGTGCCCT
ACTTGCGCAAGAATCTTAAATGGGTTGTTCAAAAGGGTGACGGCTCCATA
CCCATCAATACCCTCAAGAGCCTCAAAGTCGGTGTCTCCAGCTCGATCGT
CGAATA

NCBI BlastX