?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB23YB19FM1
Length(NT) : 665
Member of Contig: SY0AAB23YB19FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
3-hydroxyisobutyrate dehydrogenase [Aspergillus fumigatus A1163]4163e-39 gb|EDP49675.1|

Sequence:

>SY0AAB23YB19FM1
TTGGAGCTCAACCGATCTGGGATTGAGACTGCATACCTGGTACCTTAATC
ATGTTATTCCTACGGTCTCGCTACCTCTTGCCGTTCTCGAAAAGGCTCTT
TTCCACCTCTACTCGCCGTGATGCCACGTGGGGATTTGTTGGACTCGGGC
AAATGGGATACCCTATGGCTCGGAATCTACGTGTCAAGGCCTCCGCCGAC
GATATGCTTGTTATCTTCGATGTGAACAAGGATGCGACGACGCAGTTTGT
GGACGAATTAGGCTTGACGTCTAAGAAAATTGTTGTCGCGGGCAAGCTCG
AGGAGGTTGTGGATAGGAGTGACACAATTATAACTATGCTCCCTCAGCCA
CAGCATGTTAAAACTGTTTTTAGTTCTTTCCTTAATGTATCTTCTAGCCC
TGCTGGAAAGGAGCAAAAACTCTTCATCGATTGCTCGACAATCGACATAT
CTACCTCTCTTTCAGTCGGCAAGTCCGTGTGCGAGTCTGCTCTCAATGGA
CAGTTTGTCGATGCACCCGTATCCGGAGGAACTGTTGGAGCGGCTGCGGG
GACGTTAACCTTTATGGTTGGATCTGAGCCGGCACTCCTGCCCAGGATTA
TGTCTCTCCTTTCCCGCATGGGTAGTCGCGTTATCCATTGCGGACCGCCC
GGTGCCGGGTTGGCA

NCBI BlastX