?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB23YB02FM1
Length(NT) : 517
Member of Contig: SY0AAB23YB02FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein BC1G_07084 [Botryotinia fuckeliana B05.10]1562e-09 ref|XP_001554496.1|

Sequence:

>SY0AAB23YB02FM1
TTGGGATCGTGTGCTCCTTCGCGACGACGGAGGACGCCATTAGTGTGCGC
CAGGTGCTGGATGGCGAGGCAATCATGGGAGACCGTGCACGTGTTTACTT
CGGCGAGCACACACCCGTACAACCGGTGGACCAGCACCTACAGGCGCCGG
AGTCGAAGAAGATGCCCGCCATATCCGTTGATGATTATACCGATTCCGGA
GACGAGGCGAGTCCTGTTTCGCCGGTGGCTCCGGTATCGCTACACACGGC
CAGACCACCCGTCGAGCTTATTCAGGACGCTTAGATTTACTTGCTTTCTT
TCCTTTCCCTTTTTTTTTTCTTTTGCTTGCATCAAATTTTTAATATGGAT
GGAGCGGTTGTGGGTTCTATAGTTAACTGAGGTGGATGGAAGGGCGTCTT
TCAGGTGTTTTAACTGATGTTTTGTCTTTTCTTTTCTTTTCTTTTCTCTT
TACGGGTGTCCGGGGGGGTGTACTCGGGGTGGGGGTGAAGTATTGGGACA
AGCAGGGGGCTTGATGT

NCBI BlastX