?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB22YL20FM1
Length(NT) : 616
Member of Contig: Contig4223


Sequence:

>SY0AAB22YL20FM1
TTGGATACAATTTACAGCTCTGTAACTTGAATTCTAATACTTCGGAAAAT
CACTAAGCAATATGTCTTCCGACAAGCTTAAAGCCGAAGGAAACGCGGCT
TTTTCTGCGAAGGATTTCGACAAGGCCATCGGCCTCTTCACCCAGGCTAT
TGAGGTTGATCCTGAAAATCATGTTCTCTTCTCGAATCGTTCCGCATGTT
ACGCTTCTATCAAAGACTTTGACGGTGCCCTGAAGGATGCAGTCAAGTGT
ATCGAAATAAAGCCGGACTGGGCCAAAGGTCACACTAGGAAAGGTGCCGC
TCTCCATGGCCAAGGCGATTTAGCTGGAGCATTGGAAACCTATGAGGACG
CCCTAAAACTCGACCCGAACAACCCGCAGGCCAAATCTGGAGTAAAGACC
ATACAGGAGGCTATCGCTCGCGACAGCCATCAAGGCGCAGATCTCGGCAT
GGGAAACCTCTTCAAAGACCCACAATTTTTGGAAAAGCTCGCAAGAAATC
CGAGGACTTCAAGCTACCTTGAGGATGTGGAATTCATGGAAAAGCTAGAA
AGAATCCGTGACGACCCTAACCTTATCCAGACCGAGCTGCGCGATCCAAG
GATCATGCAGGTCATC

NCBI BlastX