?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB21YJ04FM1
Length(NT) : 692
Member of Contig: SY0AAB21YJ04FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
Mitogen-activated protein kinase HOG1 (MAP kinase HOG1)3283e-45 sp|Q0U4L8|HOG1_PHANO

Sequence:

>SY0AAB21YJ04FM1
TTGGCTCTCTTTTCTCCTCGCCTCCCCCTTATACTTTTTTCCACCTTTTC
TTCCCCTTTGAAATAGTAGAGCCGTACCTTGAGAGCGCGTTGAAGAATAT
TATTTTCAACCCCACTTCCGTTATCGAATTCATCCTCTCAGCAACATTTT
GTTTGCCACACGGGACCTACTCGGGATTGTACCGTACTTATCCGACGAAA
CGAAGCGAAACGGCCTGTGTTCTGTTTACTACCCACTTGGACCGCTTCAA
CCTCCCCACCCTTCTCTTCCACCTCACCCCGCCACTCGTCCATCATCCCA
GGAACAACACAGCAACAGTTCCTTGGATTACCTCGACCCTAGGCCCTTCT
ACCTAGTATTTAGCTATACTCTTCCGAACCTTTCGACATGGCTGAATTCG
TCCGCGCTCAGATCTTTGGAACAACTTTCGAGATTACAAGCAGATACACT
GATCTGCAACCCGTGGGCATGGGTGCCTTTGGTCTCGTCTGTCCGTCGCT
ATAAAGAAGATCATGAAGCCCTTCAGCACGCCGGTTTTGTCCAAGAGAAC
TTACCGTGAGCTGAAACTGCTCAAGCACTTGCGGCATGAGAATGTCATTA
GTCTTAGCGATATCTTCATATCTCCTCTGGAGGACATTTACTTCGTCACT
GAGCTTCTTGGTACTGATCTGCACCGATTATTAACCTCTCGG

NCBI BlastX