?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB20YM23FM1
Length(NT) : 649
Member of Contig: SY0AAB20YM23FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein CHGG_06554 [Chaetomium globosum CBS 148.51]2632e-21 ref|XP_001222649.1|

Sequence:

>SY0AAB20YM23FM1
TTGGCAGCCAACCTTCTTTACACAACCCCAAGCAATCTACCAACCTACCC
CTACATCCTCGCACCAGGCCGATGAGTTTTCATCTCTGTCGTTCCCAAAC
TACCCTACATTCGACTTTTTTGAACAGCAAAGCCATCACAACATTACGCC
ATCGTTAAGAGGTCATACTCCTATTGACCCAGAAACACACAGGAATGGGA
GGAGCAGCAGTGAAGAAAAGGAGTTGACACCGGGACAGCGGGTAAGCCAG
ACCGCTGATGACTCCAATGCTTCAATGGATGGTACCCTGACAGCAACACA
GAGACGGAAAGAACAGAATCGAGCAGCGCAACGTGCATTTCGGGAGCGTA
AGGAACGACATGTTAAGGAGCTGGAACACAGACTCAAGACGTTGGAGCAG
CACGCATCAGAAACAGCGTCACAAAACGAGATACTGAAGCAAGAGCTCCA
AAAGACCAAACTTGAAAACAGACTTCTGCAAGAGAACAGTCTGCGAGGCA
ACTCACCGCCGGCAATGACCGAAGTGGCAAACATGAACTTCAAGCCGACG
GACCACCACAACATCGCCAATCCCCCTCCAGCCTTCACGTCTCCGATATT
CGGGGAACACCCAAACAGAGGCCCGCTGCACAGGATTTCGACGAGCCCG

NCBI BlastX