?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB20YK19FM1
Length(NT) : 612
Member of Contig: SY0AAB20YK19FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
NUDIX family hydrolase, putative [Aspergillus fumigatus A1163]1376e-07 gb|EDP56060.1|

Sequence:

>SY0AAB20YK19FM1
TTGGCCTACATTTACAAGTTGGGATGTTAGAGGCGTTGTGTGGTTGATGA
CCCGAGAACTTAGAAAGAGGAATTGGGAGGCTGTGAGTAGGGGCAGCCTG
GGAAAAGCATTTTGCGAGAGCGAAGACACAGAGAGCAGTCTCGTCCTCGT
CAAGGAAAATGACAATGGCACTGCCAGCGCCTCGAGAGGCGAAACCACCA
GCGCCGTGAAGATTCTCTTGGAGGGGTACTATGACGTCGTGCGAAAGGCT
GTCTGGATCACTCTTTGCGGAAGGGCTGTAATCGCATCGACCGCTTTGGG
AGCTGTAGCATGGAGGTATTGGTATACGCGACGTTAGTGTATCATTCATA
GCCTGCCTCGCCTTCCGGTGACGTTTCAGGTTCCTTGCACTCAGACGCAG
AGACAACAAGGGGGAGCCGTGTGAACTGGGGGTGGTTCTTTGAGTCTGGG
GTACGGCACGGCACCAGCACCAGCAAACCGAGCTCTCTTTTTGTAACGCA
TAGCGATCCGGGGAATGGAATTATGGCATTTCTTTTTCTTCCTTCGTTAT
TTAGTTCTTGGTTGGTTGGTTGGTTGGTTGTTGGTTGGTTGGTTTGGGAT
GAAATTGGTTGC

NCBI BlastX