?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB18YD22FM1
Length(NT) : 612
Member of Contig: SY0AAB18YD22FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
probable t-RNA methyltransferase [Neurospora crassa]4952e-48 emb|CAF06164.1|

Sequence:

>SY0AAB18YD22FM1
GAGAGAAAAAAGCCAGAAAACCAGGACACAAAATGTCAACCCCGCCAACA
ACCTCAACCTCCACCTCCCCCCCAGCAAAGCGTCAGAAGCCATCCAACGG
CGAACGCACGGGCCACCGGTCTGCATATCGCTCGGATCTAACACGCCAGG
GCCTCCCGCAGAAGAAACACTACCGACAGCGCGCGCACGCAAACCCGTTC
TCGGACCACCAATTGGTGTACCCTCCATGCCCCGCTGACATGGACTGGAG
CAAGCACTTCTCCTCCCCCATCTCCACCTCCACCACCACCCCTGAAGAGA
AAAGGGTAGAAGTAGCGGACATCGGCTGCGGCTTCGGCGGCCTGATAATC
TCCCTCCCAAAGGTGCTCCCGGGCGTACGCATGCTGGGCATGGAGATAAG
GACGCAAGTGACGGAGTACGTCGACGAGCGGATCCGCGCGCTGCGACGCC
TAGCCGGCGGGGAAGCGTACGCGGACGTGGGCGTGATCAGGGCGAACGCG
ATGAAGTTTCTGCCCAATTTTTTCGAGAGGTCCCAGTTGCAGAAGGTGTT
CTTGTGCTTTCCCGATCCCCACTTCAAAGCTAGGAAGCACAAGGCTAGGA
TTGTATCGCCTA

NCBI BlastX