?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB17YK11FM1
Length(NT) : 628
Member of Contig: SY0AAB17YK11FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein MGG_02465 [Magnaporthe grisea 70-15]5095e-50 ref|XP_365763.1|

Sequence:

>SY0AAB17YK11FM1
TTGGGGAGGAAGCCCTACGGGGAGAATGGCTCAACCAGTGGACCCACTAT
TCCCAAGGGAGATGTAGGGAGCGATACCACCACGAAGGACAATCTCAGAA
TGGGCGATGATCACAGGGTCGACAACAGCTCTGAATTCGAGTTTGGAGGC
GTCTGGGGTACTGGGCTTGCTATGGTCTTCTTCCCGCTGCTCATGTGGTA
CATGTGGGTTGGCCAGGTCTACTACAATTCTCAATTCCCGATGCCAGGGA
AGGAAGAGGCAATTGGCAATTTTGTACGCAAGGTCGCTAAATTGGCTTAT
GAGTGCTCATACCCTACCAAGAAGGCTTGGTTGGTCTATTGGGGCTTCTT
GGCCTACCAGAGTTTGCTATACCTCACACTGCCCGGTGTCTGGGCCAAGG
GAAACCCAATTCCTCACAGGAACAACGTTCGTCTCGATTACTACTGCAAT
GCTATATGGGCTTTCTATTTCACTACCGCCACTGCCATTGTTTTCCATGT
GGCTCAAATCCTCCCAATCACCTTCTTGGTGGACGAGTTTGGCTCCTTTA
TGAGCGTTGGCATTCTCTCTGGGATCCTTGTCAGCTTCATCGGGTATTTC
AGCGCAATATATCGGGGTGCTCAACATA

NCBI BlastX