?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB16YP01FM1
Length(NT) : 510
Member of Contig: SY0AAB16YP01FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein CIMG_07991 [Coccidioides immitis RS]2046e-15 ref|XP_001240828.1|

Sequence:

>SY0AAB16YP01FM1
TTGGAATATATGCCATGCAGGTACCCGAGAGGTTTTACCCGGGATGTTTT
GATTGGATCGGTGGCAGCCACAACATTTGGCATGTATGTGTGCTCGGGGG
GATTTTATTCCATTGGCACGCTATGCATGATCTTTTTCACAGAGCTTTTG
AAATGGCCACTGCTTAGAACCTATCTTCCACGATTACCATTTCAACCTTT
CATTTTATTTCTTGCTTCTCGACTAAGCACCATCGATGTGAATTTCTCCC
TTACGGATGGATACTCCTTTTCCCTTGCTCCCTTGGCACCTCCATTTTGG
AGTGAGTGAGAAGTGGTTGAATGATTGATTGATTTCTACTAGAATGAGAC
AGGACAAGAGGTAATTTCGTTATATCGGCCTACTCTTATTCATTGACATA
CCTGGACTATAGAGTAATACACAAATGTGATTTGTTTGTTTCTAAGTAGA
GATTGAGGTGGATGCGAGTAGTACGAGTACTGTTACTTTTGTTTTTTCGT
TGTTTACTCT

NCBI BlastX