?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB14YP22FM1
Length(NT) : 513
Member of Contig: SY0AAB14YP22FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein NCU05253 [Neurospora crassa OR74A]1383e-07 ref|XP_961790.1|

Sequence:

>SY0AAB14YP22FM1
TTGGGTGAAAACGACTGGGGGGTTGTTATGTTCAAAGACCTTGAGGTCAA
TTTCTCCACCGGGCAGATCTCCACTGTGCTATTCCGTCCGGAGGATATTG
CCAAGGGGTTTGACCTGGAATTGGCGTTTCTGGGATACCTGTCCCTGTGC
AATCCGCAAGCTACTTTTTCAACGCTCCGGGAATGGTGCGCGCGTATCAC
CGAGCGGAGCAGGAGCGGCGCTATCGTGGAAGAAATGGGTAGGAAGTGGC
GGGAGTTCGCGGCCGGGTACGCGCTGCCCGAGGGCGATGGCGGGAGACTC
ATCGACCCGAGGATCGGAGAGCTACTATCCCTACGCGGGGCCGTGGGGAG
AAAAAGGGAAATGTTCCTGCCAACACTCTGGGAAGACACGAGCCGCGCAA
GCGCCTGGGACGTTGGTCGCGAAGTGCGAGCATTGGCCTACTCCCTCCTC
TTCCCGGGTGAAATGTCTCTGGAAGAAATCTCTAGAAGGGGTCACGGGAT
TTCTGGAGCGCCC

NCBI BlastX