?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB13YL24FM1
Length(NT) : 205
Member of Contig: SY0AAB13YL24FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
prefoldin subunit 4 [Botryotinia fuckeliana B05.10]1859e-13 ref|XP_001548837.1|

Sequence:

>SY0AAB13YL24FM1
TTGGACCGATGTAGCGGTAACCCGGGAAGACCAAGACCGTATTAACAAGT
TCTCAACGCTACACCAGAAGCAGGGACTTTTGAAAGACGAGCTTGAGAAG
AAGAGCCAAGAAAAGGAGTACATTGAAGACGTCTCTAACGAACTAGAACT
TGCGGATGATGATGACTTGATACCGTTTTCTCACCCCCCCCCCGCTATTT
TACGA

NCBI BlastX