?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB11YL10FM1
Length(NT) : 559
Member of Contig: Contig4223


Sequence:

>SY0AAB11YL10FM1
TTGGCCGCAGGCCAAATCTGGAGTAAAGACCATACAGGAGGCTATCGCTC
GCGACAGCCATCAAGGCGCAGATCTCGGCATGGGAAACCTCTTCAAAGAC
CCACAATTTTTGGAAAAGCTCGCAAGAAATCCGAGGACTTCAAGCTACCT
TGAGGATGTGGAATTCATGGAAAAGCTAGAAAGAATCCGTGACGACCCTA
ACCTTATCCAGACCGAGCTGCGCGATCCAAGGATCATGCAGGTCATCGCG
GCCCTACTGGGGCTCCAGATGGAAATGGGTGACAGTCCTGGCGGGCCAGG
GGGGGCTAGCGGATCCTTTGGGGACACAGAAATGCCAGACGCATCCGGGG
CTCCACCGCCAAAGAAAGCTGCGACTCCGCCTCCAGAGCCAGAGGACGAA
GAGGCCAAGGCTAAGAAGGAGGCTAAGGAGGCAGCGGATAAGGAGAAAGC
GCTGGGTAATGAGAACTACAAGAAACGCAACTTTGACGCTGCTATCGAGC
ACTATGACAGAGCGTGGGAATTGCACAAGGATATCACATACCTCAACAAT
CTCGCTGCC

NCBI BlastX