?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB11YC05FM1
Length(NT) : 263
Member of Contig: SY0AAB11YC05FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein NCU06714 [Neurospora crassa OR74A]2753e-23 ref|XP_960894.1|

Sequence:

>SY0AAB11YC05FM1
TTGGAAGACAACATGACAGGATTCGACGTGCTTGCCCGTAGCCTGCCGCC
AGGAAGCATGACCGGCGCGCCGAAGAAACGTAGCGTGGAAATCTTGCAGG
AGATTGAGGAGACGGAGAGAGGGGTTTACAGTGGCGTCTTGGGCTACTGG
AGTGTTTGTGGTGCTGGCGACTGGAACGTGATTATTCGTTCCGCGTTTAG
GTACGACGATGAAGTTGTCACCATGGAGGATGGGGGTGAGAAGGAAGTTT
GGAGGATTGGAGC

NCBI BlastX