?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA9YO17FM1
Length(NT) : 684
Member of Contig: SY0AAA9YO17FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein FG03419.1 [Gibberella zeae PH-1]4882e-47 ref|XP_383595.1|

Sequence:

>SY0AAA9YO17FM1
TTGGAGGCAATGCATTATCATGCTGGTATGACCAAAGATGAAAGATCATA
TGCTCAAGACGAATTTATGAACCGGAACGATTTAACGATTGTTGCCACGA
TTGCTTTTGGTATGGGCATTGATAAGCCCGATATCAGGAATATTGTCCAT
TACGACTTCCCGCGTAGCTTAGAGGGCTACAGTCAAGAAATTGGACGCGC
CGGCCGTGACGGCAACGAGAGCAAGTGTATGCTCTATCTCTGCGGAGAGG
ACTGGGTCCAACGTGAATTTTTTTGCCGCCTGGATCTGCCAAGCAAAAAG
AGTGTTAACAACCTTCTAAGGGAGCTGTTCGCATCGAATGAGGGGGTTGA
GGTCGGTGATGTCATAGAGACGGATATCAATCTGCAAAGCAGGAATCATG
ATATCAAAATAAACGCTCTTAACCTTCTCTATTCCCAACTTGAGCTTCGC
TTTGAGCTTTTGCGGGCCATCACACCAAAGTACTCGACATACAGGTTTGT
GCAGTCCGATGGTTTTGCGAGTTTTACCGCTACCGACGATCCCATCACAA
AAGTTTTGCTAGAGAGCATGCAAAAGAAAATTAAACGAAAATCAATGATG
AGATCCGTGGATATTGATCAACTCAGCCAGGAGCATGGATTCAAGCGCGA
GGAACTAGTCTATAGAATGCAGAGCTTTTCGGCC

NCBI BlastX