?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA8YM24FM1
Length(NT) : 161
Member of Contig: SY0AAA8YM24FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
glyceraldehyde 3-phosphate dehydrogenase [Galiella rufa]1242e-12 gb|AAT76626.1|

Sequence:

>SY0AAA8YM24FM1
TGTCAATGGAAAGACTATCAGGATGTACTCCGAGAGGGACCCTGCCAATA
TCCCATGGGGAGCTGCTGGAAGGTTATCATTTTGGCTCCTTCTGCCGACG
CTCCCATGTTCGTTGTTGGTGTAAACTTGGATAAATATAACAAAGACATT
ACTGTTCTCTC

NCBI BlastX