?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA7YD02FM1
Length(NT) : 650
Member of Contig: SY0AAA7YD02FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
conserved hypothetical protein [Sclerotinia sclerotiorum 1980]4153e-61 ref|XP_001594213.1|

Sequence:

>SY0AAA7YD02FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAGCAACAAAAACGACAGC
AACAGAATGCAAGCCCCGATCCAGTCTTCCCGAGCTCAGAGCTTCGACGA
AATTTACGGACCTCCAGAAAATTTCCTGGAAATAGAGGTCAAAAATCCGC
AGACGCACGGGTTTGGGAGGAAGATGTATACGGATTATGAGGTCGTTTGT
CGTACGAACATTCCGGCATTCAAGGTAAATTGCCTTCTCTCCCACCCGTT
TCTTTTCTTTGTTCTTTTTTTTTCGTGGGATGGGAAAACTAAATGGATTA
CTATCGCTGCCGTTTTTACCATAATTATAGCTCAAAGCCTCTAGCGTCCG
ACGTAGGTACAGCGACTTTGAACACTTCCGCGACATACTAGAGCGGGAGT
CCTCGCGCGTCACCATCCCCCCCTTGCCTGGGAAAGTCTTCACGAACAGG
TTCTCCGACGACGTCATTGAGCACCGCCGTGAAGGGTTGCAGAGGTTCCT
GCAAATTGTCGTTGGCCACCCACTGCTCCAGACTGGAAGCAAGGTTTTGG
CGTCGTTTGTCCAAGACCCGAATTGGGATCGTACGAGTTGGTCGATTTAA
TGGGCACTAAAGTATTGTGGGGCGTTTGTGCATGCATGGTTTTTGTGGGT

NCBI BlastX