?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA6YB19FM1
Length(NT) : 613
Member of Contig: Contig1832


Sequence:

>SY0AAA6YB19FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAGTTCCCAAGTTCCTAAAC
TCAAGTTTGTCACATCTGGCCGTTATCGTGGACTTGTAGCTTTTTTGTTT
TCTTTCTTACTCATACCTGATACTGTCTCGAGTGTCGCAACAATTCTCCT
CTTCTTCCTCTTTACCATCAACAAGCTTCCTCTACTAAACTCACTCCTCT
GCTACTCACCTGCAAAACTTTTTGTAAACTCAAACACATACTTCGTTTGC
AATCATGACCCGCACTCAGAAAGCCAACGATATCCCTCACAACCACCCCG
AGGCTGAAGCAGCCTTCAATGAGCACCAAATCCCCAAGTTCTTTGGCAAG
AGTGGCCATGTCGACACCGCTCCCAACAAGACCAAGAAGAACGGCGGTGG
AAAGGGCAACTGGGGCCTCGCCGGTGATGAATTGCAAGACCTTCCCGACG
AATACACGGTCTTTAAGGCTCGTCGTCGCTCCAATTCCATGGGCCATATC
GAGAACATGTACGTCAAGTCCAAGTTTGAAACCCTCGACGACGAACCCGT
TTTCGATGAAAGGATCCACGGAGCTGTGGGGCCCGGAGTCGCTGAGGACG
GGGCTGAACTAGC

NCBI BlastX