?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA63YB07FM1
Length(NT) : 496
Member of Contig: SY0AAA63YB07FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
Ankyrin repeat protein [Aspergillus fumigatus A1163]4124e-39 gb|EDP48589.1|

Sequence:

>SY0AAA63YB07FM1
TTGGGGTGCAGTCAAGCTACTTCTTGAGCGCGGGCATGTAAACGCCGATT
TAACAGATAATGATGGACGAGCACCACTATCATATGCAGCGAATTATGGG
AGAGAAGGTGTAGTCAAGCTACTTCTTGAGCACGGGGATGTCAACGCCGA
TTTACCAGATACTGATGGACGAACACCACTATCATATGCCGCGGAGTCTG
AGAGTGAAGGTGTAGTGAAGCTACTTCTCGAGCGTGTGGATGTCGATACC
GATTTAACAGATAAAGCTGGGCGAACACCACTATCATATGCCGCGGAGTC
TGAGAGTGAAGGTGTAGTCAAGCTACTTCTTGAGAGCGGGACTATCAATA
CCGATTTACCAGATAATCGTGGGCGAACACCACTATCATATGTCGCGAAG
TCTTGGAGTAAAGGCGTAGTCAAGCTACTTCTTGAGCGCGGGGATGTCAA
TGCCAATTTAACTGATAAAGCTGGGCGAACACCACTATCATATGCC

NCBI BlastX