?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA61YN02FM1
Length(NT) : 313
Member of Contig: SY0AAA61YN02FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
leucine-rich repeat protein SOG2 (predicted) [Schizosaccharomyces pombe 972h-]2843e-24 ref|NP_596483.1|

Sequence:

>SY0AAA61YN02FM1
TTGACTTCATTCTCGGAGGAATTCTCAAGTTTACCTCGCCTTCGATATTT
AAACCTCCGATCCAATTTTCTCAGAGAGTTCCCGTTGCCACTCACCAAAC
TGCCTTCACTTGAGATACTAGATGTTAGCCGAAATCGGCTACGATCGCTG
CCGCAGGATTTTGGGAAGCTGATGTCTTTAAAGGTCCTGTCAATGTCGAA
GAACAAGATCAATGTGCTGCCAACATATATAGGGGACATGAACGAGCTCA
AGATACTAAAGCTAGATCACAACCCCATACTATTTCCAGCAAAGGATGTT
CTGGAAAATGGGG

NCBI BlastX