?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA61YH08FM1
Length(NT) : 619
Member of Contig: Contig112


Sequence:

>SY0AAA61YH08FM1
TTGGACTACCAACAACAACAACGACAACAACAAACAACGGAAACCCTCTC
TATACAATATATATATATATATAGACTACCCCTCGAAGTTTGGAACATTC
ACAATCCCAAAACATCCTTTAACACAAAAATCCTTTACTACTTTCTTACC
TAGAAAGCTACCGACTACTGATCATCCCTTCAGCCATTCTATCAAACCGT
CAAACTGAAGTACCCAAACATTAAGAACTCCTCGAGCAATTCACTTGTTC
AACCCACCGAGCCAGCCGAAATGTCCCACTACGCGGTCCATACCGTTAAC
CCCTACCGGGGATCCACAGGCACTCTTGCCATGCCCCATTCCGCTCCTCG
CAGCGGTCAGATGGTTCCCATAAACCCCCCCTCCCCGGCCGAGTCTACCT
GCTCATCCTGCGATTCTTCGCTCCCACTCAATACCCCCTGGTCTGGGACC
CCGACTTCTTCAACCACTTCTGTTTCTACTCACCACCATCCTCACCACCC
TAGCCGCCCACGAAGACAGTCCATCAGTGATGGTGTTAGGATTGTTGAGG
CTCCCCGCATGTCAGCGGATGGCCGCCCTCCTCCTATCGTTGTTCACAGA
CGGCCCCCTGTGCCATCTC

NCBI BlastX