?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA5YB19FM1
Length(NT) : 553
Member of Contig: Contig40


Sequence:

>SY0AAA5YB19FM1
TTGGCCCGACCGGACCGTCACGAAGGTATCCTCTTGGCTCTTTCCTCTCC
CTCCCTTCCCCCCTCCGCTCCCTTTGTCCTTCGTTCGATCTTCCTTCTCG
TCCCTCGCTAGTTTCTATTAATCCTTTTCACATACCCCTTGTTTTTTTTT
TGCGTTTGTTTCGTTTGTTCCGATTGTTGTATCTTACCATCAACACAAGC
AATAGGGGATAGGATCCAGGGATAAAAATAAAACTCTCTATCACAACGGG
AGAAGGAAGGTAGCTTCTCAAGCGCCTTTAAACGACGAAAGAAACGGTTG
ATTAGAAATAAGTCGGGTTAGAATAAATCCGGCTGGGGCTACGACGACTT
CGCTTTGAAGCCGTCAAAATTCCCTACGACAGCAGCAGAAATTCCCTCCT
CGGAGGTGGACTAATACCCCAGATGCGATCAAGGATGTTTTACCGACCGA
CCTCAACGTGGAGCTGGAGTTTCCTCCTTCTCGCAATCGTTCAATCATGT
GTTGTGTTGGGTCTTGAAGGTTTTGTATTCGCTGCATTCCAGAACAACCT
GCA

NCBI BlastX