?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA58YK05FM1
Length(NT) : 599
Member of Contig: SY0AAA58YK05FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein SNOG_11068 [Phaeosphaeria nodorum SN15]1672e-10 ref|XP_001801319.1|

Sequence:

>SY0AAA58YK05FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCATCCAAATCCTTGGAGAAT
GAAGTTGGTGAATGTGCAGTTTTGGGTCTACCGGAACTGGAATTATTGCT
GTGAGAAGAAAACGGGGACCAATAGGTATTGTGAGTTTCTGGTTGCAAAG
CCGGACTGGGCATTCACCAACTTCATTATCCAAATCCTTGGAGACAGTTA
ACCATCAAAAAAGGAAATTCCTAGGAGAGTTGAAGCAATCACTAACCGGC
CTTCTCTTGAGTGACCTTGGTCTGGAGGTCTTCAGCAAGGGCAGTGAAAC
AGACGGATGGTTTTCGGGTGGCCTAGGTGATGAGTGTATCCAGAGGAAGG
AAGAGCAGGAAGAGGCCAAGCGAAAGGTTCCGGAGAAGCAATCATCAAAG
AACAGTGGTGGATCTGGCAATAAGAAACTGGCTAGAAAGAAGAGCACCAA
AAACGTTCGGAAATCCGCTAACACGGGCACTTTTGAGGCTTTAGGCAAGG
AGAAAAAGGGAGAGTTGGCGGCGCCGGTTGCCACTTTAGAAAATGTTGGC
CGTGAAGCCCACTCTGGAGAGGAGAACTCATCATCTAGCGATGCCACTG

NCBI BlastX