?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA58YI22FM1
Length(NT) : 421
Member of Contig: SY0AAA58YI22FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein NCU03546 [Neurospora crassa OR74A]2063e-15 ref|XP_956825.1|

Sequence:

>SY0AAA58YI22FM1
TTGGGATGAAGGTTACGGAGGCGACCGGGAAGACGAAGTATTTAAGATGG
ACGAAGATGAAAGCATTCCAATTGGAAAGAAGACTTGGGCAACCAGATGC
TTGGACCGAAGAGCCCCAACACCACCACCATCACCACCATCAGTCCCCTC
TACTGCCTCGGAAAGCACCTCACAGACACAGCAGCCCCAACCCATTCCAT
CACCTCTCTCTATCCCTCCGGCAACAGAATCTCCAGACCCTGGTCGCCAT
CAACGAAACCCCTAATATCCCTATACCCAAAGAAGTACTACAGCAGCCCA
TCGAACGGGTGGAACATTTCCTTCTCCTCGAAGACCTGACAGCGGGCATG
AAGAGGCCCTGTGTCCTTGACCTCAAGATGGGAACCCGGCAGTATGGCGT
CGAAGCCTCTAAGAAAAAAAA

NCBI BlastX