?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA58YD09FM1
Length(NT) : 548
Member of Contig: SY0AAA58YD09FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein CIMG_09527 [Coccidioides immitis RS]1303e-06 ref|XP_001239906.1|

Sequence:

>SY0AAA58YD09FM1
TTGGATATGATCCTGAGGCATGAGAACTTTAGCGATGATATGACGGTCGA
TATAAGGGTCGAAGAGAATCCTGCCTCATATCCACAGTATAATCTCCGAC
ACCCACAGATCATGTCTTATACTGGACCTGGGCCACGAGGCTCCTTCTCT
GGTGGAAGGAGCGTATCCCCTAGCGCTGCACGAGGGAGGAGAAGCGCCAG
TGCGGGTGGGCGCCCCAGGGGAATGAAGCGCCAAGCATCTCACCGAGGGG
AAGAGGAGCATTATGATGAGCGCTTCCCACAAGGATATTATCTACAACAG
CCCCCCCAACAGTTCTTGCCAGAGGAAGATGAGGAATCGGAATCGCGAAG
CAGGATTGAACCGGTGGCAAGTGCAGATATCAGTTTGGACAATATTGTTG
AGGGTTCAAGGAGGAAACGACCAAAATTCTCGTCTGATGAACTGCCACTG
TTCCCGCCTCCGGCCCTTCCTAGACAAGACGGTTCCACATCGTCATCAGC
CAGTCCTTCGCACCCTGCACCCCAAGTGACCACTCCTTATGGTAATCG

NCBI BlastX