?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA57YM20FM1
Length(NT) : 543
Member of Contig: SY0AAA57YM20FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
predicted protein [Aspergillus terreus NIH2624]4199e-40 ref|XP_001215388.1|

Sequence:

>SY0AAA57YM20FM1
TTGGGGTTATCATAAAGAAAGAACGAAAGAGCGCAAGTCATCAACAATGA
GCCTACCATCAACGACGCCCTCACCCAGGCCAACACACCCTTCGGGTCAC
GTATTAAACAGCTAGACTGGCTCGGCACTATCCTAAACATTGGCTCCTTC
GTCTCATTGATAATGGCGATCAACTTTGGCGGAACACTCTACGAGTGGAA
CTCCTCCCAGGAAATCACTTTATTCGTCGTTGGTGGCGTCCTCATCATCG
CCTTTGGTGTGACCCAGGCGTACTCGGTCCTCACTACTCCCGCGCAGCGC
CTGTTCCCCGGCGAATTTCTTCGTGATCCGTTTTTGGTATTGCTCTTTGC
CATGATGGCGGCTGCTTCCACCGCAATCTTCGTGCCAACATATTACATAC
CGTTATACTTCCAGTTCGTCAGAGGGGATACAGCGCTTGAAGCTGCCGTG
AGATTACTACCATTCATTATTATCATGGTGGTCTTCTGTATTGTTAATGG
CGGGGCCATGTCAAAGACCGGGTATTACGCCCCCTGGTACCTC

NCBI BlastX