?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA57YJ19FM1
Length(NT) : 516
Member of Contig: SY0AAA57YJ19FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein CIMG_05477 [Coccidioides immitis RS]6446e-66 ref|XP_001246036.1|

Sequence:

>SY0AAA57YJ19FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCTTGCTGAACCAGACCCATCTACGATTAAAGAGAGGCCAGCGT
TATGGTCTTTGTGGACCCAATGGCTCCGGAAAGTCCACCCTCATGCGCGC
TATCAACAACGAGCAGGTTGAGGGCTTCCCCAAGAAGACCGAAGTCAAAA
CTGTGTTCGTTGAGCACGATCTCGATTCTGCTGATACCGAGAAGACCGTC
GTCGGATGGACATTCGATAAGCTCGCCGAGACTGGTGCTGGTGTTTCCGT
TGAGGACATCAAGACTAAGTTGGGTGAATTCGGTTTCCAGGAGACCATGT
TTGATGCTCCTATCACTTCCCTTTCCGGTGGTTGGAAGATGAAGTTGGCC
CTTGCCCGTGCTGTGTTCGAGAACCCCGATATTCTTCTCCTGGATGAGCC
TACCAACCACATGGACAGACAGAATGTCAAGTGGCTCGAGCAATATTTGA
TCAACTCTCCTTGCAC

NCBI BlastX