?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA57YJ16FM1
Length(NT) : 504
Member of Contig: SY0AAA57YJ16FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
conserved hypothetical protein [Magnaporthe grisea 70-15]1868e-19 ref|XP_366351.1|

Sequence:

>SY0AAA57YJ16FM1
TTCCACCATCTCCCTCCTCCGACTTGATACCCGGCATCTGTTTACCGCTA
CCTAAAACATTATCACCAGCATGTTTGTAGCTAGGAATTTCCTTTCCCGC
GCTGCCGGAAATGCTCTCAGAAAGCCCCTTGTCAACATACACCGAGTAAC
TGCTTTTCAAGCTTTGAAGGCAGAGCAAAAAAATTATTCCACTGGCGGTA
CGAGAGATTATACGGTAAGGGAGGCTCTGAACGAGGCGCTTGGTATGTTG
CTCCTCGAAATTGTTGAATTGTGTTGTGTTGGGGTTGCCCCCACTAACGA
CTTCCACCAGCCGAGGAATTGGAGAGGGACGAGAAAGTACTTATTATGGG
CGAAGAAGTGGCCCAGTACAATGGGGCTTACAAAGTCACCAAGGGATTGT
TGGATCGTTTTGGCGAAAAGAGAGTTATCGATTCGCCGTAAGTTTTCTGG
CGTGAGTTTATGAGAGGATATGCTAACCTTACCTAAAGAATTACGGAGCA
CGGT

NCBI BlastX