?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA56YE10FM1
Length(NT) : 603
Member of Contig: SY0AAA56YE10FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
mitochondrial carrier protein [Neosartorya fischeri NRRL 181]2254e-17 ref|XP_001259461.1|

Sequence:

>SY0AAA56YE10FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGTAACAGGACATGACATT
TCACAAAACCTCCCTGCCCTACTACCAGTACCGGTAAGCCCTATTCTACC
TACTGTACACCACCTTTACCACACCTCCTTTACCCTTTGCCCTCCTCGTC
CCACCACTGCCGCCACTAGAAACTTGACCCAGAAAGCGCAATGTCTACGA
CATTAGGCGGCTTCATCGCCGGTAATCGCAGCCTGCGGAGCAGTAACAGT
CACTCACGGCTTCGAAACGGTGAAAACAAGGTGCGTATCATAACCGCACG
CTACACATGTACCTACACACATACACCGGCTTCGGACATGAGAATGTCCC
CCGGGAGAGTGAGGGGGTTGCGGGAGCAAAACAAAAAGTGAGCTGCGCTT
ACAAAAATTGCTATGCGGGTGGGCAGACTTCAACTCCAAGGCGAGCTTTC
AGCAAAGTCGCAAACGAAACGAGTCTACACAGGTGTATTCCAGGGTGTTC
GAGTGATCTTGGTAAACGAAGGGCCGCGTGGCTTAATGGCTGGTTTGGGC
GCTGCTTACTGCTACCAAACCATGCTAAATGGCTGCCGTCTCGGCTTCTA
CGA

NCBI BlastX