?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA55YI10FM1
Length(NT) : 668
Member of Contig: SY0AAA55YI10FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
ubiquitin-conjugating enzyme E2-18 kDa [Ajellomyces capsulatus NAm1]4188e-56 ref|XP_001543565.1|

Sequence:

>SY0AAA55YI10FM1
TTGGCACCCACTCTACTACGACAACCCCACAAAGCAGATGAAAAATGGAA
AACATTAAAAAAGCCCCAATGCCCTCCTCGCACAAGCCCTAACCCTCTTC
TCATACTCCTTTCGGTCATCCCTCCAAATCTTGGAAGCGTCAATATTCGC
GCCGCTCTCGTCGTTCGGCTCTGCAAGCATGCTCATGACGCTGATGAGTA
TCTTCTCAACACTCTGTATTGGCGACCAACGCTCGCTGGCATCCTCATAC
TGGTTCGGGTCGTCACCGGGAGAGTGTAGTATTGAGATGCACACGGTGCC
GTCCTTGTACACATTCGGATGGAACATTTCGCAGGTGAATTTCATCTTGG
GAGGATTAAGGGGGTAGTCCTGTATATATCTTAGTTAGCTGGCTGGAGTA
GAGATTTTCTTTTTCCTTTTCTTGTTTTGTTTGTACACGAGTAATTGGGT
AGAGATTGGTTCTGATCTTTTTTTTCTCTTTCCGCCCGCCCCTGCCTGGT
AGATACATTACATACCTTTGGAAAACTGAGCGTAGCGGGAAAAACCCCGC
CTTCGAATGGAGTCTCCTCCGGACCTTGGATTAAGCATTCCCATTCGAAG
AGGTTGGATTCGTCGATGGGCCCGGCGGCGATGCCTTCCGGGGATTCCTT
CAGCAGGGCTTTGTATTC

NCBI BlastX