?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA55YD04FM1
Length(NT) : 563
Member of Contig: SY0AAA55YD04FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
saccharopine dehydrogenase [Sclerotinia sclerotiorum 1980]3197e-43 ref|XP_001593244.1|

Sequence:

>SY0AAA55YD04FM1
TTGGGTGTAAACCGCTTGAGCACCGCTCTGCCCTTACTCCCGCCACTACC
AGCGCTCTTTTAAACGCTGGTTATGATGTCCGTGTCGAGCGTAGTGAGCA
GAGAATCTTTGATGACAGTGAGTTTGAGAAGTAAGTCCAATACATTTCGG
GGCACTTTTCTTAGGGGATAACTTGTTAATTACTCAAAAGGGTCGGTGCT
ACGCTTGTTCCCGAGGGCTCCTGGACTGGTATGTTGAGCCACCCACCTTG
TGCTAAATTCCTGCGCTGAGCGAGTGACCATTGCAATTCTCAATCCAGAG
GCACCCGTGGACCACATAATTATTGGCCTTAAGGAACTCCCTGATGATGA
CTTCCCTCTCAAGCATACTCACGTCCAATTCGCCCATTGTTACAAGAACC
AAGGTGGCTGGGAAAACGTACTCTCTCGCTTCCCCAGGGGCAAGGGCACT
CTCCTAGACTTGGAATTCCTTCAAGACGATAACGGTCGTAGAGTTGCTGC
GTTCGGCTATCATGCTGGATTTGCCGGCGCTGCACTAGGTCTTGAGGTTT
GGGCATGGCAGTA

NCBI BlastX