?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA54YN11FM1
Length(NT) : 485
Member of Contig: SY0AAA54YN11FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein CIMG_01888 [Coccidioides immitis RS]3354e-30 ref|XP_001248117.1|

Sequence:

>SY0AAA54YN11FM1
TTGGTGAGAGAGTGTGAGCGAGAGGGGAAAACGTTCGTCTTCCGACCACT
ACACCATGGCAGGAAAAATGTTGCAAGATCTTACGGATCAGTTTCAGGCT
CTGTCCAAAGACATGAGCTCTATCGTCGAGGCGCGACAAAAATTAGATTC
GCAGCTTCAGGAGAATAGGTCTGTACAAAAGGAATTTGCGAACCTGGCCG
ATGATGCAAAGATCTACAAGCTCGTTGGGCCCGTGCTCGTTAAGCAGGAC
AAGTCGGAGGCGGTAATGAATGTGGATAAAAGATTGGAATTTATCAACTC
AGAAATCGCGCGCATCGAAAAGCAGATCACCGACATTCAAGAGAAGCAGG
AACGGAAAAAGATGGAAATCATTCAGGTTCAATCTCAACTACAACAAGAT
GCCCAAGCGCAAGTAGGAGCATAGTCTAAATTCTAAGAAGGAAAAAGAAA
CCATTCAAAAACCACCCTTTCCCAAATCATACTGC

NCBI BlastX