?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA53YK15FM1
Length(NT) : 643
Member of Contig: SY0AAA53YK15FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein CHGG_00913 [Chaetomium globosum CBS 148.51]1932e-13 ref|XP_001220134.1|

Sequence:

>SY0AAA53YK15FM1
TTGGCAAGTGCAAGCGTTAAGGATGTCGTGAAGCTCGTGGAAGGTGACCC
CGAACACACGGTGCCCATTTTGTTTACTTCATCTGTCAACGGACAAGGGG
TTGACCTACTCCATGAGTTGATTATGAGACTTCCAGTACCTGAGCCCCCT
GAAGCACCGAGGGCGTTAAATGCTCTTGGGCCTTTGCTAGGCGCTAGCTC
GGTGGGTGTCAAGGAAGGGACGCAGAAGATCAGGGTAGATAAAGGAGAGC
CGAGGGTTGTAATGGAGGAAGACTGCGGATTGTCCACTTTGTTCCATCTC
GAGGAAATCTATGGATTTCAACCCGCGCATAGTGCAGAGGATGGGAATCG
GGGGGCTGTGGTTGGTGGGCATGTCAAGTATGGGAAAATCTCTATTGGTG
ATGAGTTGCTGGTTGGGCCCCTAACGCCTGTCGACCATACCAGCAACCCG
CCATCAGCCGAAGGGACTCCTGCTACTCCTGCCCCCCATCCTCTGCTATC
ACCATCTGTCGGCCATTTGCCGGGGCTCATGTCCAAGAGCCCAGACAGTG
CTAACGAGACGAGGGCCACCTCTCGTAAGCGATCCGGACTAAAAATCACA
CGTGGTGACGATACTGTGCATAGCAGTGCGTCTGGCGAGGACT

NCBI BlastX