?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA52YM07FM1
Length(NT) : 675
Member of Contig: SY0AAA52YM07FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
unnamed protein product [Aspergillus oryzae]2632e-21 dbj|BAE55410.1|

Sequence:

>SY0AAA52YM07FM1
TTGGCCGTCGACCGGTGCTTCAACGTCAACAACGCCCACTCCTACTGCTG
GCACCACCACCGCCACCACCACCGTTGTTGCTAACAAGACAGTTAGTGGA
GCCACTGGTACAGGTGTTAAACGCGCGCATGCTTCGTCCAATGCCATCTC
GAATAAATCTAGGTCTGCGGCGAATTACCCGAGGAAGAGGGCTGTGAGCG
CGTGTCTGGTTTGTCGGGGGAGGAAGACGAAATGCGATAACCAGCGGCCG
CAATGTGGATTTTGTAAGCAGACGGGGGCGGAATGTGTTTACGAGGCGGA
AAAGTTGGCTACATTCGACGCCGCCTCATTGGCGATTCTGGATAAGCTCT
CCAGGATAGAAGCAATGCTGGATTCAGACCGGGGCTCAAGCAATCAGCAG
CACACGCCTACCAGTCACCCTTCCCCACACACCTCGGGTTCCACAACCAG
CGGCGGCGCCGTGCAAATACCTTCCCTACCACCGCTCACCGCACGCGGTA
GCTCGCCGAAGAGCGTGGGGAGCAAACCGCCCCCAGATGCCTCCGAGATA
TTCCCCGTCTCCGTCGCTACAGCCTCGGGATCCCGTGTCGAGGACCTCCT
CCAATGGCCAATATTCAACGGACAATTCTGCGTGGAGGAGATCCTTGCAC
CAGTATTTGCGGATTCCCACGGTGA

NCBI BlastX