?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA52YJ18FM1
Length(NT) : 640
Member of Contig: SY0AAA52YJ18FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
glutamate synthase [Gibberella fujikuroi]9316e-99 emb|CAJ20840.1|

Sequence:

>SY0AAA52YJ18FM1
TTGGCCCAGCCCCTACGGTGGGTAGCTCACAATGGTGAGATTAACACGCT
GCGTGGTAACAAAAATTGGATGCGAGCACGTGAAGGCCAGATGAAATCTG
CTAAGTTTGGAGAAGAGCTGGAGCAGTTATACCCCATCATCGAGGAGGGG
GGGTCCGATTCTGCGGCGTTTGATAACGTTCTTGAGCTGCTTACTATAAA
TGGTGTCCTTTCCCTACCGGAGACCATTATGATGATGGTTCCCGAAGCCT
GGCAAGATAATGCTCTGATGGACCCCAAGAAAGTGGCCTTCTATGAATGG
GCTGCCTGCTTGATGGAGCCTTGGGACGGCCCAGCATTGTTTACTTTCGC
GGATGGGAGATACTGTGGTGCTACATTGGATCGTAACGGCTTAAGGCCAT
GTAGATTCTACGTAACGGATGACGACCGCATTATTTGTGCATCCGAAGTC
GGCACTATCTTGATCGATCCAGAGCACATTATCCAGAAGGGTAGATTGAA
GCCTGGGAGGATGCTTTTAGTAGATACTGTGGAAGGGCGGATAGTTGATG
ATAAGGAGCTGAAGATGGGGGTGTCTTCTCGGTTCGATTTCACTTCATGG
GTCGAAGAACAATTACTCACCATTAAGAAAGTATATAACC

NCBI BlastX