?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA52YI21FM1
Length(NT) : 628
Member of Contig: SY0AAA52YI21FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
unnamed protein product [Aspergillus oryzae]1412e-07 dbj|BAE61056.1|

Sequence:

>SY0AAA52YI21FM1
TTGGCGACTTCCTCATGTTAGAACCGGTCTTGCATGGGTTGTCATCAATC
TCACCTGGCGCGAAGAACATGAAGATATCGAAGAGGTTCACGCTCGAGCT
AGGGAGCTAATTAGGCTAGGGTTTGATAAGAGCTTAGAAAGCATGTCTCA
GGATTCCGAGCTGGACGTCAGAGAGAGAGTTAAGACTGCCAGACATCAGT
TGAGCACTGTTGGGCCTGCGGATTAACTGTTGCCACTACCTACCTACAAT
TCGAACCGCAAGGATCTGTGTATTACTACTGGGCTCTGGGTCTCTTTGTC
TTTCTACTCTTTATACCAATCACCTGTTTTTCTTCCCCCCTCCTGTTATC
TAACAGAGGGATAGGGGTGAAGTACACAGGTGAGGTTGCTTTTCTCTTTT
TTCTAATACTTTTTTTTTTTCTTCTGCGAATTTTCATGCCTTTGATTTTC
GAAGGGTTCATTTATCGCAGTGCCATGCGGGGGGGGACGTGGAAAAAAAT
CTTTACTGCGGGCTATTTGGTTGGCTATGGGCTCTTTTCCTATGTTAGCT
ACCGGTAAGGGGTCATTGGTTGGTTTAAGGGGGTTTCGCAATTTTCATTC
GGAATTGAAAAAAGTGGGTACTTTTTTT

NCBI BlastX