?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA49YG02FM1
Length(NT) : 368
Member of Contig: Contig160


Sequence:

>SY0AAA49YG02FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGCGTGATTCGACCAGCCCC
GAAAGATCCTCAAAATCTTTTCCAGGCAATCGCGGAGACGGTGCGTGTGG
GCAATTCCTCGGGTGTCTCCTCCACGGCTTCACGCAATTCGGTGTTGTGT
GTCGCTTCCGACGGGTTGATTCTACCAGCATTTGGTGCTCCAATCGAGAC
GAAAAAAGAATAGATCGCAATTTATCTCGACCACCTCTCCCCTCAAACCT
TTCACCCCAATTACCCTCCCTCCCTCACTCTCTCCCCTCTTAACTCTTCG
CCCCTCTCATCTCTCCCTCACCACCACCACCAATACACCCTCCACTGTTA
TAAGAACAACACCTTTCT

NCBI BlastX