?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA44YN14FM1
Length(NT) : 468
Member of Contig: Contig1221


Sequence:

>SY0AAA44YN14FM1
TTGGCCTTTTGGGAGCAACCCCCGTACTTTTTCCTGTCAATCAATCAGCT
TTTTGCTCCTGCCGCTGCTCTACCTGCTACCACCTGCGACCATCACCGTT
CCTCCGGCACCGCACCCACACAACACAGCAATCTTGCAACACAGCCCGCC
TTCTTCTTCATCTCGCTACCTGTCCTGTCCTTTTCCGTCCTCTTACCCGC
ACAACACCCTCACAATTCAACAGCACAACCAAGTTCTACTCGTCCTTTTC
TTCACCACCACCACCCTCTCGCTACCATCATCAACACCGTTAACTTGAAC
CTTCCATCGTTTTCTCCCTGTTAGCATTCATACAAGTAAATATTCCTGTT
GACGCTTAACTGAAGCAGCTATCCTGTCGCTTCATCACAACCGCAGGCAT
AGCTAGATAGGAGAGAAGAAAAGTTGGGAATTAGCTTTTTCTACCTTTAC
CCTCCTGCTATCACGGAC

NCBI BlastX