?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA43YK07FM1
Length(NT) : 718
Member of Contig: Contig1170


Sequence:

>SY0AAA43YK07FM1
TTGGGTCGAAGAGAAGAGGGGAAGAAGGTAAAAAAAAAAAAACCGTGAGA
GAAAGGCCTGAGACCAATCTCCTCCTGACTGAACAGAAAGACTGACCTCG
GAGTCAGTCGCGAACGTGACAACTTGCTCGCTTCCTCTTATCCGTCTTTT
GGGGTAACGTCTTTGTATAAGACCTGCACTGTCTTCCCAACCCACGATTC
AACTGTCTCCATTCCAGAACAACTCCAAAACGTCCACTAATTCAATATGT
CGGATAACGAAGACTCCAAACAGTTTGCCAAGGAAAGGCCGATATCGACC
ATCGCGCGGTCCTTCTCCGCGCAACTGAACGACGCGTTCCTGATTGATGA
TACATTGGACCAGTTGTCCTCTACCGTCGAGCAAAAAAAGCTCTCGGTAA
CCTTCCACTCGAAAGAACTGGAAGAGTTGGAAGCGCGGATTCGCCGCGCT
GAAGCTCTCCTGGAGGAGAAGAAGAAACGCTTCTCCGAGCAGCTCCCCGG
CGAGCAACCCTCCGATCTATCAGCCCCCAGCACTCGCCCCGCTAGGCAGT
CAATGCCCGACCACGACCAACCGGAAAGCTCGCAGGCTGCGGCTGCTCCA
CCAAACAGACCTGCTCCTGCCCCGCCAGTTGCCAATGGTGGCAGCGCTAA
GGGTGAGTTCGTGGTGATTGAGAAATCGGCCAGCATGCCTGGCGAGTCGG
GGAATGGCCCCCCTGCTG

NCBI BlastX