?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA32YP03FM1
Length(NT) : 505
Member of Contig: Contig1764


Sequence:

>SY0AAA32YP03FM1
TTGGCCCTTCCCCTTCCCCTTCATTCCCTTATCTACCCCCTTCCCCCTCC
GTCCATTCAATTCCCAACGGTTCAACTTCACTCTTTCGTCGTGTTAATTC
TTTGTTGCTTTTTTCAAACTTCAACGTCTGTTTGAACGAACCCCTTGCTC
TATCCAACGTTTGATACAACAGCAGCAACCAGAATGGGTGTCTTGTCAAC
TTTGTTGGTCCCCATGGGACCTTACTATGAAGAGCTTATGAGGCTTGGTG
GACCTGCATTGTGTGGAATTGGGTTCATTGCTTTTGTTGTGCTGTCCGTC
ATTATCAATGTCCTCCAACAGCTACTTTTTGTGGACCCTACGAAGCCTCC
AATGGTCTTCCATTACTTTCCATTTTTCGGTAGCACGGTGATGTACGGAA
TGGATCCTTACAAGTTCTTTTCTGGGTGCCGGGAGAAGTACGGGGATGTC
TTTACTTTTGTCATGCTGGGAAGGAAAATGACGGCGACATTGGGTCCTAA
GGGGA

NCBI BlastX