?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA2YI14FM1
Length(NT) : 655
Member of Contig: Contig1620


Sequence:

>SY0AAA2YI14FM1
TTGGCGCAAATCTGATTTACAGCGCCATCACCGGATACATACGAATGAGA
GACCGTACTCCTGCACCTTTCCTAATTGTGGGAAATCCTTTATTCAGAGG
AGTGCCTTGACCGTTCATACCCGAACACATACTGGCGAGAAGCCCCACTC
GTGTGAATATATTGGATGTGGAAAATGCTTCTCAGATTCCTCTAGCTTAG
CTCGACATAGGCGCATTCACACGGGGAAGCGGCCTTATAGCTGCCCCATT
GACAAGTGCGGGAAAAGTTTCTGTAGGAAGACAACTTTGACAAAGCATGC
GAGAAAAAATCACCAACTTCGGGCAGAAAATGATGTGTCGGATGATGATG
TAGAGGAGAGTGATGATGATGATCTCTCGCCTAAAGCATCAGGCAAGGCT
GGATCGCGGGCTCAGTCGAAAAGGTTGACGAAAGCTTCAGCTAGGAGAGC
AGCTCCTCCTTCAGCTCCTAGTCGCCCTAGCGTTCTGCGAACAAGCTCTT
TTGCTGAGCCCCTAACTCCTCATAGTCCTCAATCCACTGTCAGGTCCGGA
CATTCAAGTCGAAATACGAGCTTTTCCGCAGCTTCAGATTCATATCGTCA
CTCAATGCCTATGGCCATGACGCACTCCGTGCATCAACATCAGCCGCCGA
CACCC

NCBI BlastX