?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA26YM13FM1
Length(NT) : 579
Member of Contig: Contig103


Sequence:

>SY0AAA26YM13FM1
TTGGGGTTCCTGCCCGCTCACAGATCGCACCCACACTCTCACTCACAACT
CACAGGACAATGTATCACTTGTAGTTTCCATCGCCTTCTTACCCGTGGTA
CGCGGTTGCCTAGAGCTGCTCATTCATACATGCTTTGAGGTACCCTACTC
TAGGTGTATCGTAGAGTACGTATGTATGGTTGTTGCCTGTCTTCAGCCTC
TCTCTCATTCCTTCGCCCAGACAGAAAAATATCGTGCAGGCCTTCTATTT
CGATCGCTTTCGGCGTTCTTCGCCCTTCTCACTCTAACCTCGTATGTGGC
GAACCAATTTAGATCGCTTGATCACCACCGGTCATGGTTGGGCGGGAAAA
AGAATAAACGACCAAAGGGTTGCGATTCTCATGGAGATCCGGATCACAAA
TTCACATACCTCATTCAGAGGAATACGGTGTTTGTGACTTACTAATGCCT
AATGGGTGCTACCTTTCTGTCCCCTCCACTAGAAATGGCCGGCATGAGCG
CTTGGAAAGGGAAGCAAAGCAATAGAAGGTGTGCTATTCTATTTCAGGTC
ACTCTCCCCCCACCCCCCTTCCCTTTGTT

NCBI BlastX