?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA25YE05RM1
Length(NT) : 452
Member of Contig: SY0AAA25YE05RM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
predicted protein [Aspergillus terreus NIH2624]1258e-06 ref|XP_001214749.1|

Sequence:

>SY0AAA25YE05RM1
ATGATAACACGACTTCCCTTCACGAAGAAAACCAAAGTCTATCTGGTGCC
TCTGCAGGGTAGATAACCATCTATATAATACACAATCCCACATCCGCGCA
AAGAATAACAAACAACACCCACCAATAAACGCCAGCTGGAACCAAATCTC
ATGATACAGCCCATAAAGCGGGGGAGAAAGCTAAAAGGCCAATAATGCCA
GAACCCTCTCCCCAATACTAAGTTACTTACAACTAATCATCTCTCCTCTG
CACCCTCTCCTTCTCCCTCTCCACCCACCTTCCAAAATCCTTCCTGAACC
CGCCACCCTTCCCTTTCACTCCCTCTTCAAATGTCACGACCTTCCCAACC
CCGCTCTCGGTCCCAACGCCACCAAGGTCCAGTAACGGGATCATCGAAGG
TCTCCCATGCGCGCACTGAAACGGAAACTTGCACTCCGCTAGTTTGCCAA
TC

NCBI BlastX