?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA24YM05FM1
Length(NT) : 452
Member of Contig: Contig1060


Sequence:

>SY0AAA24YM05FM1
TTGGGTCTAGAGAAACACTCTCGACTTTTCTCAGAGCCCAATCAATTTCT
CCTGCATCTCCTCATTCACCTCTCTATTTCCCTGCACCTTTAGAGATTCA
TAGACCCGAGAAGATAGCAAACAACCATTGCCATGGCTGAAACCTTCGAA
TTCCAAGCTGAGATCTCTCAGTTGCTCTCCCTCATCATTAATACTGTATA
CTCGAATAAGGAGATTTTCCTTCGAGAATTGATCTCCAATGCCTCAGACG
CTTTGGACAAGATTCGCTACATTTCTCTTTCCGACGCTAGCGTCTTGGAA
GAGGAGAAGGATCTGAAAATTCACATTATCCCTAACAAGGAGGCCAAGAC
TCTTTCAATTTTTGATACTGGTATCGGCTTTACTAAATCTGATTTGGTAA
ACAATCTTGGTACCATTGCCCGATCTGGTACAAAGCAGTTCATGGAGGCC
CT

NCBI BlastX