?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAA24YL13FM2
Length(NT) : 555
Member of Contig: Contig4465


Sequence:

>SY0AAA24YL13FM2
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCCAGCTTCGCGGAGGGGGC
GAAAGAGGCGGATGTGGTGTTCCTGCTTGTGCCGGATCAGGTTGCGCCTG
CCCTATACAATTCAGAGATAGGGCCCAACCTGAGGACGGGTGCGTTGGTG
GTCGTAGCGAGTGGGTTTAACGTCTTTTATAAAAGGTTGGAGGTTGAGGG
TGTTGATGTTGGCATGGTTGCGCCGAGGATGATTGGTGCGGGTGTTAGGA
GTAGGTTCCTGGAAGGGGGAGGGTTTCCGTGCTTTGTTTCTGTAGAGAAT
AATTTCAGTGGAAGGGCGCTGGAAATGATCTTGTCCCTTGCCTTGGGGAT
AGGAGGGTTAACGGCTGGTGCTGTCGAGTGCTCTGCTCGCGACGAGACGC
TCATGGACCTATTCGCTGAGCAAGCGGTCTGGCCGAGTATTATCGTCGCA
TTTAGAGAGGCGTATTCCACTGTTCTCCACCATTCCGCTCCCCCTCCCCC
TCCCCCTTCACCTCCCGCTTCGGCTAACCGTCATAGTTGAAAAAACTCGG
CTGCT

NCBI BlastX